Skip to main content

Table 2 The primer and TaqMan probe sequences of DRD4, 5HTR2A and GNB2L1

From: Potential diagnostic markers of olanzapine efficiency for acute psychosis: a focus on peripheral biogenic amines

Shot gene name Sequence (5′ – 3′) Gene name
DRD4 Forward primer GGC CAT GGA CGT CAT GCT
Reverse primer TGA TGG CGC ACA GGT TGA
FAM -TGC ACC GCC TCC AT- RTQ1
Human D4 dopamine receptor
5HTR2A Forward primer GCAAGATGCCAAGACAACAGATAA
Reverse primer TCACACACAGCTCACCTTTTCAT
FAM -TGGTTGCTCTAGGAAAGCAG- RTQ1
Human 5-hydroxytryptamine (serotonin) 2A receptor
GNB2L1 Forward primer GAA TAC CCT GGG TGT GTG CAA
Reverse primer GGA CAС AAG ACA CCC ACT CTG A
R6G - TAC ACT GTC CAG GAT GAG A - BHQ2
Human guanine nucleotide binding protein beta polypeptide 2-like