Skip to main content

Table 2 A list of primers used for real-time PCR

From: Abnormal expression of rno_circRNA_014900 and rno_circRNA_005442 induced by ketamine in the rat hippocampus

GeneBi-directional primer sequenceAnnealing temperature (°C)Primer length (bp)
β-actin (Reference)Forward:5′CGAGTACAACCTTCTTGCAGC 3′
Reverse: 5′ ACCCATACCCACCATCACAC 3’
60202
rno_circRNA_014900Forward:5′ CTTAGATGACCTGGAGAAGACCT 3′
Reverse: 5′ TGACTTGGTGCTGTTGACTTTAG 3’
60124
rno_circRNA_013109Forward:5′ ATTATAGAGCTAATTACAACTTCCG 3′
Reverse:5′ TTATCTGAAGCATGTTAAGACAATA 3’
60105
rno_circRNA_006565Forward:5′ CGACTTCAAAAGAGTTGTGGATT 3′
Reverse: 5′ TTCTCCTCGTGAGCTTTTTTCTC 3’
6054
rno_circRNA_005442Forward:5′ ACCCCATGAGAAAGACCAGGTC 3′
Reverse:5′ CTGCTCTCTTCAAGTGAAAGACATC 3′
6060
rno_circRNA_003460Forward:5′ CGCTAAGCATTTCTTTGGAA 3′
Reverse: 5′ GTAGTGGGTGTAGGGAGGAGA 3′
6076