Skip to main content
Download PDF

Association of verbal and non-verbal theory of mind abilities with non-coding variants of OXTR in youth with autism spectrum disorder and typically developing individuals: a case-control study

BMC Psychiatry volume 24, Article number: 30 (2024) Cite this article

Abstract

Background

The ability to attribute mental states to others is called theory of mind (ToM) and is a substantial component of social cognition. This ability is abnormally developed in individuals with autism spectrum disorder (ASD). Several studies over the past decade have identified the oxytocin receptor gene (OXTR) and its variants as promising components for explaining the molecular mechanisms underlying Theory of Mind (ToM). The main aim of this study is to examine the association between rs2268498 and rs53576, two functional single nucleotide polymorphisms (SNPs), and verbal and non-verbal ToM in children and adolescents with ASD and a group of typically developing youth.

Methods

The study involved 44 children and adolescents with high-functioning ASD aged 8 to 18 years old and 44 TD individuals who were matched on age and sex. In all participants, blood samples were collected and rs2268498 and rs53576 were genotyped. Happe’s Strange Stories test and the moving shapes paradigm were used to measure verbal and non-verbal ToM in all participants.

Results

The results of permutation tests and logistic regression suggested that in TD group, rs2268498 AA carriers showed significant higher scores in variables representing verbal ToM (ToM stories and appropriateness score) whereas, in ASD group, rs53576 AA carriers exhibited significant better performance in parameters related to non-verbal ToM (ToM general rule and intentionality score). The results of hierarchical clustering in both groups support the findings by distinguishing between language-related and language-independent aspects of ToM.

Conclusions

In the present study, we examined the association between rs2268498 and rs53576 and social functioning in individuals with ASD and TD group. We found preliminary evidence that rs2268498 and rs53576 are associated with ToM related abilities in healthy individuals as well as in autistic individuals. Accordingly, rs2268498 and rs53576 may play an important role in predicting ToM capabilities. It will be necessary to conduct further research to address the association of genetic variants with a deficit in ToM in individuals with ASD.

Peer Review reports

Background

As far as social evolution is concerned, Homo sapiens is almost universally acknowledged as a highly social species capable of complex aspects of social functioning [1]. Humans’ ability to perceive social cues, motivation to interpersonal interactions, and maintaining relationships with others distinguishes them from other species, even the most closely related ones like chimpanzees [2,3,4,5]. In order to achieve competency in social interaction, we need to have social cognition, social motivation, social awareness, and skills in maintaining relationship with others. Recently, social cognition has attracted more attention and been studied in greater depth due to its hierarchical and multidimensional nature [6]. As a basic component of social cognition, Theory of Mind (ToM) is noteworthy. According to the definition of the ToM, it is the ability to attribute others’ behaviors to their mental states which are based on social stimuli [7]. Impairment in ToM ability may result in neuropsychiatric symptoms, with autism spectrum disorder (ASD) standing out as a prominent example [8, 9]. According to the Diagnostic and Statistical Manual of Mental Disorders, fifth edition (DSM-5), ASD is characterized by repetitive behaviors/restricted interests, as well as social communication difficulties which reflects ToM dysfunction or “mindblindness” [8, 10].

While ASD is enigmatic in its etiology, there are several studies discovering endophenotypes relating to genetic markers of this disorder [11]. In this regard, family and twin studies as well as genome wide association studies (GWAS) of human social behavior and social cognition have helped to clarify the heritability of these traits and the contribution of genetics to their development [12,13,14,15]. In light of these findings, it has become increasingly apparent that oxytocin (OXT) plays a central role in many aspects of social behavior, including ToM which is impaired in some neuropsychiatric disorder including ASD [16,17,18]. OXT is a 9-amino acid neuropeptide which is mediated through the OXT receptor (OXTR) [19, 20]. Located on chromosome 3p25, the OXTR gene encodes the human OXTR protein-coupled receptor class I G, consisting of three introns and four exons. In addition to being primarily expressed in the reproductive system, OXTR expression can also be detected in several brain regions such as the frontal cortex, amygdala, hypothalamus, and olfactory nucleus [20,21,22]. Therefore, it is not surprising that several single nucleotide polymorphisms (SNPs) within the coding, noncoding, and regulatory regions of OXTR have been associated with social cognition deficits as seen in ASD. A significant association between rs2254298 and rs53576 with autism in families has been found in Chinese Han population [23], Also a significant association between rs2268493, rs2254298, and rs53576 and high-function autism in Caucasian families [24, 25], sheds light on the potential association between OXTR SNPs and ASD. Additionally, some studies have stepped further and studied the association of OXTR SNPs with social endophenotypes underlying the autistic symptoms. In this regard, Yang et al. (2018) reported a significant association between rs2254298 and social deficit in ASD, while Skusea et al. (2014) found that rs237887 was significantly associated with human social recognition skills among individuals with ASD as well as individuals with first-degree relatives with ASD [26, 27].

In the context of different OXTR SNPs, rs2268498 and rs53576 appear to be two of the most promising candidate SNPs putatively associated with individual differences in social functioning. rs2268498 is a regulatory SNP located on 2 KB upstream of OXTR in promoter region. In 2017, Reuter et al. identified the significant association of rs2268498 G allele (AG, GG) with higher expression of OXTR in human hippocamp tissue and HEK-293 cell line [28]. This study suggests that the rs2268498 genotype may contribute to the regulation of the OXT biological pathway by regulating the expression of OXTR in brain. Upon discovering this finding, further researches were conducted to determine whether the rs2268498 genotype was associated with social cognition manifestations. The effects of rs2268498 A allele on non-verbal social perception [29], facial emotion recognition [30] and empathic concern [31] are a few examples of how rs2268498 may influence social cognition. Furthermore, rs53576 is an intronic SNP which is located within intron 3. The location of rs53576 raises the possibility that rs53576 may also play a role in the regulation of OXTR expression. A significant association of rs53576 GG genotype with social auditory processing [32], different empathy domains in Asian and European populations [33], and higher attachment-related anxiety [34] support a possible association of rs53576 with social relationship.

With regard to the above studies, it appears that it has largely been neglected in attempts to examine higher levels and more complex characteristics of social cognition. One of the basic components of social cognition which has received relatively scant attention is ToM. To date, little research has been conducted on OXTR SNPs, including rs2268498 and rs53576, in association with some related aspects to ToM. For instance, little information is available regarding the association of rs53576 with the Reading Mind in the Eyes Test (RMET) and the false-belief task, both of which are known to be ToM tasks [35, 36]. However, the missing link, which has not been addressed as it should, is language. Given that language plays an influential role in the development of ToM, it could be considered to be an important factor. Therefore, ToM capabilities can be categorized based on its relation with language skills. As of yet, few studies have tried to discriminate ToM skills based on the usage of language. In this regard, verbal ToM abilities refer to ToM skills that directly engage higher level verbal/linguistic abilities. For example, according to the findings of Šimleša et al., in verbal ToM tasks, individuals must be able to comprehend a particular mental state by following narratives and vignettes or express others’ mental state by using true linguistic expressions [37, 38] In contrast, as Kobayashi et al. stated in their study, non-verbal ToM skills require minimum verbal demands to understand and express abstract subjects’ intentions [39]. As of yet, different cognitive tasks have been developed and measure different aspects and components of ToM skills. Some of them assess ToM verbally, whereas the others examine non-verbal ToM abilities. Among ToM tasks, Happé’s Strange Stories test is the most prominent test which measures verbal ToM in particular [38]. Moreover, although most of the cartoon-based ToM tasks are able to measure non-verbal ToM components, Frith- Happé animation task (also known as moving shapes paradigm) can assess both verbal and non-verbal components of ToM [40]. It should also be noted that Happé’s Strange Stories test and Frith- Happé animation task specialized to evaluate verbal and non-verbal ToM components in both children and adolescents with high-functioning autism and have been validated (normalized) in different languages including Persian [41, 42]. So, it seems that these two tasks can distinguish ToM abilities based on the usage of language in children and adolescents with high-function autism as well as typically developing children and adolescents. Besides, most previous researches have focused on the associations between rs2268498 and rs53576, as well as other OXTR SNPs, and social cognition features in typically developing populations not ASD people. Thus, further investigations are required to bridge the gap between ToM and the molecular underlying mechanisms from the perspective of verbal abilities in both typically developing and ASD individuals.

Hence, the purpose of this study is to examine whether rs2268498 and rs53576 can be used to model verbal and non-verbal ToM abilities as well as other aspects of social functioning among typically developing children and adolescents and those with high-functioning ASD.

Methods

An overall total of 88 unrelated individuals participated in this study. Forty-four individuals with ASD and forty-four typically developing (TD) individuals were recruited in the study. High-functioning ASD individuals were patients at the outpatient clinic of Roozbeh Psychiatric Hospital during the last year. The medical records of these individuals were made available in full coordination with the dean of the hospital, the parents/caregivers of these people were contacted and the study was explained to them, and the ASD individuals whose parents/caregivers agreed to participate in the study were included in the study and underwent cognitive and genetic measurements. ASD group consisted of 12 females and 32 males between the ages of 8 and 18. In the ASD group, participants were diagnosed as having high-functioning autism spectrum disorder (mild to moderate ASD) by an expert child and adolescent psychiatrist at the Roozbeh psychiatry hospital outpatient clinic based on DSM-5 criteria. Individuals with ASD had no comorbid neuropsychiatric conditions (such as attention-deficit/hyperactivity disorder, bipolar disorder, depression, epilepsy, etc.), and Intelligence quotient (IQ) scores of 90 or higher at the time of participation. The TD participants were recruited through online advertisements. Parents of the TD group were informed of the study after announcing their willingness to participate. Participants in the study were those whose parents consented to their children participating. The TD group was composed of 18 females and 26 males of matched ages and sex. Parental reports indicated that the TD participants had no family or personal history of psychiatric conditions and a minimum IQ score of 90 was obtained by TD individuals. Participants in both the ASD and TD groups participated voluntarily, had Iranian ancestry, and at the time of the study did not have any diseases related to the immune system (cancer, autoimmune disorders, etc.).

Procedure

After informed consent was obtained from parents, participants were guided to a quiet room between 9:00 AM and 11:00 AM in order to complete the tasks. Moving shapes paradigm and Happé’s Strange Stories tasks were selected as measures of non-verbal and verbal ToM, which were administered in a pseudorandom sequence. Each participant was administered Raven’s progressive matrix test in order to determine their IQ level after completing the ToM tasks. A psychiatric examination interview was conducted with their parents based on the last six- month behaviors of the participants. Following the cognitive/ behavioral assessments, further molecular tests were conducted. The research has been approved by the Tehran University of Medical Sciences Research Ethics Committee, which is in compliance with the Helsinki declaration (IR.KHU.REC.1399.021).

Measurements

Cognitive and behavioral measurements

In order to establish the diagnosis and severity of the symptoms parents of individuals with ASD were interviewed using the Childhood Autism Rating Scale (CARS). The CARS is comprised of 15 items that assesses ASD symptoms. Each item in CARS is scored between 1 (absence of abnormality) and 4 (severe abnormality). A cutoff point of 25.5 is considered to be indicative of a high-function ASD, and a score of 25.5 or higher is indicative of a preclinical diagnosis of mild ASD. All individuals in the ASD group achieved a CARS score of 25.5 or greater [43, 44].

An adapted version of the moving shapes paradigm (aka Frith-Happé animations) [45] and a formerly validated Happé’s Strange Stories test [46] were used to examine the non-verbal and verbal ToM abilities of all participants. Each task was displayed on a 17-inch monitor while the responses were recorded. For the verbal ToM assessment, three blocks of unlinked, human, and ToM stories from Happé’s Strange Stories test were utilized. Each block contains eight vignettes and each vignette is scored from 0 (irrelevant) to 2 (relevant/specific). A question was asked after each story about the characters’ utterances and the main context in which they appeared. After the task was completed, participants received three scores, ranging from 0 to 16. The higher scores of strange stories test the better performance of the participant. Non-verbal ToM was measured using the moving shapes paradigm. The paradigm contains three blocks of random, goal-oriented, and ToM animations. Each block includes four short silent animations with two colored triangles as characters. The participants should accurately convey the storyline and describe the triangle’s intention at the end of each animation. The following variables were derived from the participants’ responses: (1) general rule (GR) = Correctly describing the animation’s intentions for each block (Random, Goal-directed, ToM), (2) intentionality score (IN) = to determine the ToM level of sophistication in the used words (3) appropriateness score (AP) = to retell the storyline in the correct sequence. A validation study of the moving shapes paradigm provides more details about the task.

rs2268498 and rs53576 genotyping

Genomic DNA was extracted from 0.5 ml of peripheral blood using Salting-out protocol. By UV-spectrophotometry, the quantity of extracted DNA was determined and the presence of a sharp and clear band, in line with the ladder one kb band, on 1% agarose gel electrophoresis gave an indication of DNA quality. DNA contamination with other chemical and biological components was also measured using the 260/280 and 260/230 ratios of absorbance. Both SNPs were genotyped utilizing restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP) based on previous researches [47, 48]. To digest both rs2268498 and rs53576, BslI (catalog number: #ER1201) and BamHI (catalog number: #FD0054) restriction enzymes were respectively employed, and primers were designed and checked for specify leveraging primer-blast’s web-based platform (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). In the case of rs2268498, primers (forward: 5’ TAGGCTGTCTCACGGGCTAC 3’, reverse: 5’ TCGGCCTCGAAAATTACAGA 3’) were designed to anneal the DNA template at 58°C during 35 PCR cycles. The 448 bp PCR product was digested overnight at 37°C and digested product was run on 2% agarose gel electrophoresis for genotyping (AA: 266 bp,131 bp, 52 bp/ AG: 266 bp, 229 bp, 131 bp, 52 bp, 36 bp/ GG: 229 bp, 131 bp, 52 bp, 36 bp). Initially, the annealing temperature of primers for rs53576 (forward: 5’ GCCCACCATGCTCTCCACATC 3’, reverse: 5’ GCTGGACTCAGGAGGAATAGGGAC 3’) was 58 °C [49]. After 35 cycles of PCR, we obtained a 340 bp PCR product. A 30-minute digestion at 37 °C was followed by 2% gel electrophoresis and genotyping (GG: 340 bp/ AA: 120 bp, 220 bp/ AG: 120 bp, 220 bp, 340 bp).

Statistical analysis

Statistical analyses were performed using the R programming language version 4.2.2 (R Core Team, 2022) in the RStudio environment in accordance with a 95% confidence interval (CI). Basic R commands and dplyr (https://CRAN.R-project.org/package=dplyr), tidyverse (https://doi.org/10.21105/joss.01686), vegan (https://CRAN.R-project.org/package=vegan), cluster (Maechler, M., Rousseeuw, P., Struyf, A., Hubert, M., Hornik, K.(2022). cluster: Cluster Analysis Basics and Extensions. R package version 2.1.4.), StatMatch (D’Orazio M (2022). _StatMatch: Statistical Matching or Data Fusion_. R package version 1.4.1, https://CRAN.R-project.org/package=StatMatch), factoextra (Kassambara A, Mundt F (2020). _factoextra: Extract and Visualize the Results of Multivariate Data Analyses_. R package version 1.0.7, https://CRAN.R-project.org/package=factoextra), and dendextend (Tal Galili (2015). dendextend: an R package for visualizing, adjusting, and comparing trees of hierarchical clustering. Bioinformatics. DOI: https://doi.org/10.1093/bioinformatics/btv428) packages were recruited in order to write statistical test codes. Additionally, the findings were visualized using the ggplot2 package (H. Wickham. ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag New York, 2016.). Pearson’s chi-square test and Wilcoxon test were used to compare demographic data including sex and age between ASD and TD groups. The haplotype analysis of rs2268498 and rs53576 was carried out based on expectation-maximization (EM) algorithm using Haploview software version 4.2 in order to ensure that there was no physical linkage and linkage disequilibrium (LD) between rs2268498 and rs53576. Besides, the deviation of both rs2268498 and rs53576 from Hardy-Weinberg Equilibrium (HWE) was estimated by “genetics” package (Gregory Warnes, with contributions from Gregor Gorjanc, Friedrich Leisch and Michael Man. (2021). genetics: Population Genetics. R package version 1.3.8.1.3. https://CRAN.R-project.org/package=genetics) recruitment. With the use of the permutation test, rs2268498 and rs53576 associations with Happé’s Strange Stories test, moving shapes paradigm, and IQ score were investigated within and between groups. Furthermore, hierarchical clustering was employed in order to distinguish different aspects of ToM based on similarities and differences in parameters extracted from Happé’s Strange Stories test and moving shapes paradigm. As a final step, in order to compare feature detection abilities between SNPs (rs2268498 and rs53576) and hierarchical clustering, and to investigate the relation between cognitive parameters and both rs2268498 and rs53576, a general linear model (GLM) with logistic regression was used. Besides, for each equation in GLM, odds ratio \(\left( {{\text{OR}}\,{\text{ = }}\,{\text{log}}\left( {\frac{p}{{1 - p}}} \right)} \right)\) and p was calculated. It is important to note that, except for the within-group analysis, all statistical tests involving both ASD and TD groups used regression out method to adjust the effect of IQ.

Results

Demographic results

Pearson’s chi-square test indicated that there were no significant differences between the two groups based on gender (p = 0.260). Additionally, Wilcoxon test results did not reveal significant differences in age between individuals with ASD and TD group (p = 0.391). However, the IQ of the TD group was significantly higher than that of the ASD group, despite none of the participants attending exceptional schools (p = 1.883 × 10− 4). Therefore, IQ is controlled by regressing it out. A summary of the demographic results can be found in supplementary material 1 Table 1.

rs2268498/rs53576 HWE and haplotype analysis

There was no significant deviation from HWE for rs2268498 and rs53576 based on Pearson’s chi-square test (p rs2268498 = 0.519, p rs53576 = 0.358). Additionally, rs2268498 and rs53576 do not exhibit a strong linkage based on the statistics and parameters obtained from haplotype analysis. In this respect, it could be considered that these two SNPs may act independently of one another. (D’ = 0.436, LOD = 3.070, r2 = 0.143). An overview of the HWE and genotype distribution is provided in supplementary material 1 Table 2.

rs2268498/rs53576 and IQ score assessments

Meanwhile, it has been indicated that IQ score was significantly associated with rs53576 genotype across ASD and TD individuals (p-value = 0.028). Further analysis revealed that while there was no significant association between rs53576 genotype and IQ score in TD participants (p-value = 0.647), in ASD group individuals with rs53576 GG genotype had significantly lower IQ scores than A carriers (p-value = 0.023).

rs2268498/rs53576 and ToM assessments

The differences between ASD and TD group in performing ToM tasks (Happé’s Strange Stories test and moving shapes paradigm) have been indicated in our previous finding [50]. In brief, there was no significant differences between ASD and TD group in performing unlinked (p = 0.841) and human stories (p = 0.784) blocks of Happé’s Strange Stories test as well as random animations GR of moving shapes paradigm (p = 0.853). However, the results revealed that in ToM stories blocks of Happé’s Strange Stories test (p ≤ 0.001) and other moving shapes paradigms components including Goal-directed GR (p ≤ 0.001), ToM GR (p ≤ 0.001), IN (p ≤ 0.001), and AP (p ≤ 0.001), ASD group have significant lower scores than TD group. These findings implicitly revealed that ASD individuals could follow the tasks’ instructions as well as TD individuals.

In total sample, Happé’s Strange Stories task results revealed a significant association of rs2268498 with ToM stories, but not with human or unlinked stories (p ToM = 0.003, p human = 0.056, p unlinked = 0.883) which was replicated in both TD and ASD groups separately (p ToM−ASD = 0.018, p ToM−TD = 0.010). In the TD group, the rs2268498 AA genotype was significantly associated with higher scores in Happé’s Strange Stories task human and ToM blocks (p ToM−TD = 0.005, p human = 0.027), while in the ASD group, the rs2268498 AA genotype was significantly associated with higher performance only in the ToM block (p ToM−ASD = 0.019).

In rs53576, there was a significant association between rs53576 and ToM stories block in the total sample population (p ToM ≤ 0.001, p human = 0.192, p unlinked = 0.527) but not in each group separately (p ToM−ASD = 0.081, p ToM−TD = 0.094). It shows that this significant difference arises from differences in ToM stories residual scores between individuals with ASD and TD individuals. Table 1; Fig. 1a & 1b provide detailed information regarding the results.

Table 1 Association analysis of rs2268498/rs53576 × ASD/TD with Happé’s strange stories test variables
Full size table
Fig. 1
figure 1

Association of rs2268498 with verbal ToM in both groups. NS refers to non-significant. (*): p-value ≤ 0.05, (**): p-value ≤ 0.01, (***): p-value ≤ 0.001

Full size image

The results of the moving shapes paradigm indicated that in total samples, rs2268498 was significantly associated with ToM and goal-directed GR, as well as IN, but not with random animations GR and AP (p ToM ≤ 0.001, P goal−directed = 0.002, p IN ≤ 0.001, p random = 0.339, p AP = 0.070). In within groups analysis, rs2268498 was only marginally associated with AP in the TD group (p ToM−ASD = 0.647, P goal−directed−ASD = 0.175, p random−ASD = 0.109, p ToM−TD = 0.215, P goal−directed−TD = 0.289, p random−TD = 0.437, p IN−ASD = 0.444, p IN−TD = 0.627, p AP−TD = 0.047). Further analysis showed that rs2268498 G-carriers scored significantly lower in the AP variable than AA carriers in the TD group (p = 0.032).

For rs53576, it was indicated that rs53576 was significantly associated with goal-directed and ToM animations GRs, IN, and AP but not random animations GR in the total sample (p ToM = 0.002, P goal−directed = 0.004, p IN ≤ 0.001, p AP = 0.031, p random GR = 0.370). Within group analysis indicated that rs53576 was significantly associated with the goal-directed animations and the ToM animations GRs and IN scores in the ASD group but not in the TD group (p ToM−ASD = 0.039, P goal−directed−ASD = 0.006, p random−ASD = 0.279, p AP−ASD = 0.698, p IN−ASD = 0.013, p ToM−TD = 0.356, P goal−directed−TD = 0.695, p random−TD = 0.402, p AP−TD = 0.571, p IN−TD = 0.265). Additional investigations revealed that in the ASD group, individuals with rs53576 AA genotype scored significantly higher in goal-directed and ToM animations GRs (p ToM = 0.039, P goal−directed = 0.027, p random = 0.636), while carriers of rs53576 GG genotype scored higher in IN variable but not AP (p AP = 0.310, p IN = 0.014). Figs. 1c, 2a, 2b, 2c and Table 2 provide additional statistics.

Fig. 2
figure 2

Association of rs53576 with non-verbal ToM in both groups

Full size image
Table 2 Association of moving shapes paradigm variables’ residuals with “rs53576/rs2268498 × grouping”
Full size table

Hierarchical clustering results

Using hierarchical clustering of dissimilarity matrix distances and for both ASD and TD groups, four clusters of cognitive parameters were found. According to the dendrograms, the cognitive variables were classified into four clusters based on the distance matrix: (1) General non-verbal characteristics regardless of ToM sophistication (random, goal-directed, and ToM GR), (2) The ability to consume verbally regardless of ToM sophistication (unlinked, human, and ToM stories), (3) The capability of acquiring non-linguistic ToM (IN), and (4) The ability to acquire verbal ToM (AP). Fig. 3a and 3b present ASD and TD clustering results. As a result of visualizing 2-dimensional K-means clustering, it was revealed that in the TD group, the parameters representing similar ToM features (verbal/non-verbal) have a relatively smaller distance from one another than other variables. Meanwhile, the parameters illustrating verbal and non-verbal ToM were visually farther apart from each other in the ASD and TD groups. Fig. 3c and 3d illustrate 2-dimensional clustering in more detail.

Fig. 3
figure 3

Hierarchical clustering results visualization. Hierarchical clustering of ToM parameters’ dissimilarity matrix distance in TD (a) and ASD (b) groups and 2-dimentional k-means clustering in TD (c) and ASD (d) groups

Full size image

General linear model and logistic regression

None of the ToM parameters in the ASD group was predicted by the rs2268498 AA genotype. However, in the TD group, the rs2268498 AA genotype was significantly associated with AP, human, and ToM stories, which are partially associated with verbal ToM and verbal skills (βhuman = 1.423, p human = 0.019, OR human = 4.150; βToM = 2.286, p ToM = 1.440 × 10− 4, OR ToM = 9.838; βAP = 2.333, p AP = 0.023, OR AP = 10.312). Using GLM results for rs53576 in both groups, it was found that in ASD group, rs53576 AA genotype significantly predicted GR of goal-directed and ToM animations, and GG genotype significantly predicted IN responses (βgoal−directed = 1.583, p goal−directed = 0.047, OR goal−directed = 4.870; βToM = 1.532, p ToM = 7.270 × 10− 3, OR ToM = 4.631; β IN = -7.324, p IN = 0.016, OR IN = 6.596 × 10− 4). The rs53576 AA genotype was also found to be a significant predictor of ToM animations GR in individuals who were TD (βToM = 1.699, p ToM = 0.035, OR ToM = 5.470). There is a detailed presentation of GLM results in supplementary material 1 Table 3.

Discussion

In this study, we examined the association of two OXTR non-coding SNPs, rs2268498 and rs53576, with verbal and non-verbal ToM abilities and model ToM skills in ASD and TD participants independently. Based on the convergence of results from permutation tests and GLM analysis, it was determined that rs2268498 AA genotype was significantly associated with verbal ToM in the TD group, whereas rs53576 AA genotype was significantly associated with non-verbal ToM in the ASD group. Moreover, it has been suggested that rs53576 was significantly associated with IQ score in ASD patients.

This finding could be attributed to the evolutionary role that OXT and OXTR play in the social perception of vertebrates, particularly mammals. In 2022, it was demonstrated that homozygous deletion of the Oxtr could result in social isolation in eight-week-old zebrafish [51]. Also, earlier in 2016, it was suggested that OXTR expression changes in the Nucleus Accumbens (NAcc) play a significant role in the regulation of social behavior in prairie voles. According to the results of this study, there are several non-coding polymorphisms in the OXTR regulatory and intronic regions that are associated with altered OXTR expression in the NAcc [52]. This may lend support to the contention that OXTR plays a significant role in social perception in mammals.

As discussed earlier, due to the complexity of social cognition processes in humans, OXTR has a much broader and more complex impact on humans than it does on other species. As a result, the effects of OXT and OXTR variants can be observed in humans from prenatal development to adulthood, as well as in daily social interactions seen in individuals with social cognition impairment such as ASD. As an example of the effect of OXTR variation during infancy, it was reported in 2015 by Unternaehrer et al. that maternal behaviors in childhood have a significant impact on OXTR methylation pattern during adulthood. The study discovered that individuals who received less maternal care during childhood exhibit significantly higher methylation of OXTR during adulthood, which is significantly associated with the incidence of psychiatric disorders [53].

Particularly in the case of ASD, several studies tried to shed light on the association of OXTR with ASD and its related phenotypes. The association of SNPs linked to OXTR with ASD likelihood according to meta-analyses results [54], the correlation of genetic and epigenetic modifications of OXTR with aberrant social behavior [55], the association of ASD clinical features (e.g. seizures, panic, and aggressive behaviors) with OXTR SNPs [56], the association of rs53576 with social, emotional or behavioral functioning in children and adolescents [57], and the relation of OXTR polymorphisms with social impairment in children with and without ASD [58] are illustrations of studies that find significant associations of OXTR variants with ASD and its correlated traits.

The results of this study (association of rs53576 with non-verbal ToM performance in ASD group) are largely explained by this previous evidence. While different studies have demonstrated the association between various variants of OXTR and maternal behavior effects on toddlers, rs2268498 and rs53576 stand out in this field due to their significant interaction with environmental factors both during childhood and adulthood. In 2019, Smarius et al. suggested that five-to-six-year-old children who had the GG genotype in rs53576 and were exposed to verbal violence by their mothers, as well as same age children who were carriers of the A allele in rs2268498 (AA and AG) and were exposed to verbal violence by their mothers, showed a significant increase in systolic blood pressure [59]. In addition, Sicorello et al. in 2020 attempted to identify associations between rs2268498 and rs53576 and everyday social behaviors, such as social buffering, among healthy individuals. Their results demonstrated that G carriers of both rs2268498 and rs53576 exhibited lower social company requirements after stressful events [60]. In light of the findings discussed above, it is implied that rs2268498 and rs53576 together and alongside each other may be significantly associated with social functioning. As a result, further investigation may be needed in order to gain a deeper understanding of the mechanisms behind the association of rs2268498 and rs53576 with social cognition. Regarding this approach, Laursen et al. investigated the association between rs2268498 and rs53576 polymorphisms and cognitive empathy in 2014. The results indicated that healthy individuals who hold the CC and AA genotypes at rs2268498 and rs53576, respectively, displayed significantly higher levels of empathic concern [61]. Moreover, in 2019, Meixner et al. assessed if rs2268498 and rs53576 are associated with language-based ToM through the use of a word-processing task. The results illustrated that rs2268498 A carriers and rs53576 G carriers showed weaker bias in conditions measuring emotionally positive self-related words [62]. Thus, it could be anticipated that rs2268498 and rs53576 may also be associated with verbal ToM on the basis of such an observation. In this respect, our findings demonstrate a positive association between the rs2268498 AA genotype and validated parameters pertaining to language-based ToM abilities in typically developing children and adolescents. However, in the case of the association of rs53576 with IQ our findings suggest the association of rs53576 GG genotype with lower IQ scores in ASD individuals. This seems contradictory to some extent [49]. Hence, this should be evaluated in other samples and population for replicability. In this regard, it is worth mentioning that a number of previous studies have also examined the association of OXTR polymorphisms and validated ToM tasks. Hence, some studies have attempted to determine if there is a significant association between OXTR SNPs and well-known ToM tasks such as the Reading Mind in the Eyes’ Test (RMET) and the false-belief task. The obtained results showed no significant association between OXTR SNPs and false-belief task performance in healthy populations regardless of age [36, 63], whereas RMET accuracy in healthy adolescents and young adults was significantly associated with rs53576, rs2254298, and rs2228485 [35]. While rs2268498 has been shown to be significantly associated with autistic traits in healthy young adults [64], no study has yet been able to find an association between OXTR variants and ToM tasks such as RMET in population with ASD symptoms [65]. Moreover, considering that individuals with ASD may also present language delays, it may be more appropriate to use language-related and language-free ToM tasks separately. In this regard, our results clearly illuminated that rs53576 is associated with non-verbal ToM in individuals with ASD. Despite of findings regarding association between rs53576 and rs2268498 with different aspects of ToM, including this study, the accuracy and reliability of these findings are still in question. In light of this, it appears that these results require assistance on a computational level. Using the matrix distance principle, we have found that linguistic and nonlinguistic ToM differ from one another in both ASD and TD individuals. According to our results, rs53576 was associated with parameters that represent verbal ToM in the ASD group, while rs2268498 was associated with variables indicative of verbal ToM in the TD group.

ToM can have various manifestations in everyday life. These manifestations can range from following social cues during infancy to complex abilities intertwined with other cognitive functions, such as language and face processing. Both rs2268498 and rs53576 have indicated significant associations with different aspects of ToM or of which ToM itself is a part (e.g., empathy, face emotion recognition, social cognition, etc.). However, the question that arises before deep diving into the discussion about the association of rs2268498 and rs53576 with these aspects of ToM is that considering the fact that these two variants are located in the non-coding regions of the OXTR gene, how and through what mechanisms they have association with ToM? Regarding rs2268498, since this SNP is located in the promoter region of OXTR gene and has a significant association with OXTR expression at the cellular level [28], it can be concluded that the association of rs2268498 with ToM is moderated by OXTR expression. Different studies have uncovered the association between rs2268498 and ToM. Previous findings suggested that rs2268498 has a significant association with identifying and utilizing social cues as well as social learning which in turn can represent ToM [29, 66]. In addition, rs2268498 genotype can predict prosocial behavior and empathic concerns, both indicators of ToM [31]. More importantly, rs2268498 illustrated association with facial emotion recognition, an ability that directly reflects ToM associated functions [30].

rs53576 is a non-coding SNP located in intron 3. Up to now, no study has revealed the exact cellular and molecular mechanisms through which rs53576 affects ToM. However, it can be assumed that rs53576 could play a role as a cis-SNP and regulate OXTR expression itself or be a trans-SNP for other genes associated with ToM. As of yet, a wide range of investigations have tried to demonstrate the association of rs53576 with ToM and its associated traits. In infants, rs53576 has a significant association with visual attention to the eyes as social cues [67]. Additionally, it has been shown that rs53576 is significantly associated with RMET performance [35] and Hinting Task [68] which both are ToM measuring tasks in typically developing individuals. ToM has, however, been largely correlated with empathy and rs53576 in previous studies. While Gong et al. demonstrated the association of rs53576 with empathy in general [69], the study of Chander et al. revealed that rs53576 GG genotype is associated with greater cognitive empathy in Asian cohorts [33]. Moreover, McDonald et al. studies, rs53576 moderates the relation of parent-child interactions with children’s empathy [70]. Sociality, sociability, social cognition abilities, face processing, and facial emotion recognition are other manifestations of ToM associated with rs53576 [71,72,73,74]. rs53576 is not just associated with ToM in typically developing populations. Some studies have indicated the association of rs53576 with ToM in individuals with psychiatric symptoms. As an illustration, rs53576 is significantly associated with ASD [75], Asperger syndrome [76], and autism related social impairment and social communication difficulties [58, 77]. Furthermore, rs53576 has also shown a significant correlation with ToM in individuals with treatment-resistant schizophrenia [78], bipolar disorder type I [79], and attention deficit/hyperactivity disorder (ADHD) [80]. Lastly, few studies evaluate the association of rs53576 and ToM at the neural level. Association of rs53576 with N1 event-related potential component during performing a social task [81] and correlation of anterior cingulate and supplementary motor area activity with rs53576 during performing an empathic task [82], are studies indicating the relation of rs53576 and ToM at neurobiological level.

Despite all the studies mentioned above, no study distinguished verbal and non-verbal ToM variations using rs2268498 and rs53576 across high-functioning autistic and TD individuals. There is only one study in 2019 that evaluates the association between rs2268498 and rs53576 with emotional words related to self and others [62]. Therefore, this study is the first evaluation to discriminate verbal ToM components from non-verbal ToM using rs2268498 and rs53576 across ASD and TD individuals, and the results have implicitly been validated by hierarchical clustering.

While many aspects have been discussed so far, the most pressing question here is through which neurobiological mechanisms OXTR affects cognitive and behavioral functions related to ToM? There are two levels of explanation for these questions: cellular and neurobiological. At the cellular level, there is scarce evidence for OXTR function in neurons. The general consensus is that the OXT and OXTR signaling pathways in neurons are similar to those in uterine smooth muscle cells. Only in 2022, Meyer et al. showed that in HEK293 cell lines, mutation in OXTR (A218T) leads to OXTR protein stability, shift in Ca2 + dynamics, which ends in MAPK pathway activation reduction [83]. Meanwhile, it is generally accepted that neurobiological changes bridge the gap between cellular modifications associated with OXTR genetic variants and ToM characteristics. In 2014, Brian W. Haas et al. published one of the first studies in this field. The results of this study indicated that OXTR is significantly associated with social endophenotypes. These endophenotypes include brain regions such as dorsolateral prefrontal cortex (DLPFC), Ventromedial Prefrontal Cortex (VMPFC), Visual Cortex (VC), Premotor Cortex (PMC), and Anterior Cingulate Cortex (ACC), which are essential for various social cognition processes, including emotion recognition and social reward, social communication, empathy, and ToM. Researchers hypothesized that OXTR is associated with social traits indirectly by affecting these brain regions [84]. Thus, when it comes to rs53576, homozygote individuals with GG genotype who experienced insecure childhood attachments have shown higher brain gray matter volumes in the left amygdala and lower volumes in the right superior parietal lobule, left temporal pole, and bilateral frontal regions during the ToM paradigm [34]. In addition, Uzefovsky et al. in 2019 found significant association between rs53576 GG genotype and hyperactivity in the right supramarginal gyrus (rSMG) and inferior parietal lobule (rIPL) during RMET (as a ToM task) whereas AA genotype was associated with topological patterns in brain functional networks [85, 86]. Nevertheless, little is known about the association between rs2268498 and brain scale endophenotypes. For instance, Zimmermann et al. showed that rs2268498 AA is associated with Amygdala functional connectivity [87]. Considering these findings together, they shed light on the association between rs2268498 AA genotype and rs53576 GG genotype and changes in brain regions related to ToM. In this sense, our findings at the cognitive level were implicitly aligned with the results of those studies.

The main limitation of this study was the sample size. Due to limitations in budget, time, facilities, and time overlap with COVID-19 pandemic we could not expand the sample size enough. However, using accurate statistical methodologies (e.g., permutation tests) we could overcome this limitation to some extent. Further, advanced assessments using neuroimaging techniques and assays that measure other DNA variants with larger sample size are required to evaluate the accuracy of these findings.

Conclusions

In conclusion, here, children and adolescents with ASD and typically developing individuals, matched on sex and age in the Iranian population were assessed for verbal and non-verbal ToM as well as OXTR two variants, rs2268498 and rs53576, respectively. It was discovered that rs2268498 could significantly predict verbal ToM of TD participants, whereas rs53576 could significantly predict non-verbal ToM of participants with ASD. Additionally, the genetic and hierarchical modeling results aligned with each other and showed partial agreement. In order to ensure that the results of this study are reliable, further examinations will be required.

Data availability

The dataset supporting the conclusions of this article is available in G-Node GIN repository (https://gin.g-node.org/ranaghamari/OXTR).

Abbreviations

ACC:

Anterior Cingulate Cortex

AP:

appropriateness score

ASD:

Autism Spectrum Disorder

CARS:

Childhood Autism Rating Scale

CI:

Confidence Interval

DSM-5:

Diagnostic and Statistical Manual of Mental Disorders, fifth edition

DLPFC:

dorsolateral prefrontal cortex

GR:

general rule

GWAS:

Genome Wide Association Study

HWE:

Hardy-Weinberg Equilibrium

IQ:

Intelligence quotient

IN:

Intentionality score

LD:

linkage disequilibrium

NAcc:

Nucleus Accumbens

OXT:

oxytocin

OXTR :

Oxytocin Receptor gene

PMC:

Premotor Cortex

RMET:

Reading Mind in the Eyes Test

SNP:

single nucleotide polymorphism

ToM:

Theory of Mind

TD:

Typically developing

VMPFC:

Ventromedial Prefrontal Cortex

VC:

Visual Cortex

References

  1. Tomasello M. The ultra-social animal. Eur J Social Psychol. 2014;44(3):187–94.

    Article  Google Scholar 

  2. Green MF, Horan WP, Lee J. Social cognition in schizophrenia. Nat Rev Neurosci. 2015;16(10):620–31.

    Article  CAS  PubMed  Google Scholar 

  3. Happé F, Frith U. Annual research review: towards a developmental neuroscience of atypical social cognition. J Child Psychol Psychiatry. 2014;55(6):553–77.

    Article  PubMed  Google Scholar 

  4. Happé F, Cook JL, Bird G. The structure of social cognition: in (ter) dependence of sociocognitive processes. Ann Rev Psychol. 2017;68(1):243–67.

    Article  Google Scholar 

  5. Huber L, Plötner M, Schmitz J. Social competence and psychopathology in early childhood: a systematic review. Eur Child Adolesc Psychiatry. 2019;28(4):443–59.

    Article  PubMed  Google Scholar 

  6. Fiske S, Taylor S. Social cognition. Mcgraw-Hill Book Company; 1991.

  7. Premack D, Woodruff G. Does the chimpanzee have a theory of mind? Behav Brain Sci. 1978;1(4):515–26.

    Article  Google Scholar 

  8. Baron-Cohen S, Leslie AM, Frith U. Does the autistic child have a theory of mind? Cognition. 1985;21(1):37–46.

    Article  CAS  PubMed  Google Scholar 

  9. Isaksson J, Van’t Westeinde A, Cauvet É, Kuja-Halkola R, Lundin K, Neufeld J, et al. Social Cognition in Autism and other Neurodevelopmental disorders: a co-twin control study. J Autism Dev Disord. 2019;49(7):2838–48.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Association AP. The diagnostic and statistical manual of mental disorders, (DSM-5). Philadelphia: American Psychiatric Association; 2013.

    Book  Google Scholar 

  11. Sandin S, Lichtenstein P, Kuja-Halkola R, Hultman C, Larsson H, Reichenberg A. The heritability of autism spectrum disorder. JAMA. 2017;318(12):1182–4.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Ebstein RP, Israel S, Chew SH, Zhong S, Knafo A. Genetics of human social behavior. Neuron. 2010;65(6):831–44.

    Article  CAS  PubMed  Google Scholar 

  13. Scourfield J, Martin N, Lewis G, McGuffin P. Heritability of social cognitive skills in children and adolescents. Br J Psychiatry. 1999;175(6):559–64.

    Article  CAS  Google Scholar 

  14. Tick B, Bolton P, Happé F, Rutter M, Rijsdijk F. Heritability of autism spectrum disorders: a meta-analysis of twin studies. J Child Psychol Psychiatry. 2016;57(5):585–95.

    Article  PubMed  Google Scholar 

  15. Warrier V, Chee V, Smith P, Chakrabarti B, Baron-Cohen S. A comprehensive meta-analysis of common genetic variants in autism spectrum conditions. Mol Autism. 2015;6(1):1–11.

    Article  Google Scholar 

  16. Feldman R, Monakhov M, Pratt M, Ebstein RP. Oxytocin pathway genes: evolutionary ancient system impacting on human affiliation, sociality, and psychopathology. Biol Psychiatry. 2016;79(3):174–84.

    Article  CAS  PubMed  Google Scholar 

  17. Guastella AJ, Hickie IB. Oxytocin treatment, circuitry, and autism: a critical review of the literature placing oxytocin into the autism context. Biol Psychiatry. 2016;79(3):234–42.

    Article  CAS  PubMed  Google Scholar 

  18. Sun R, Vuillier L, Deakin J, Kogan A. Oxytocin increases emotional theory of mind, but only for low socioeconomic status individuals. Heliyon. 2020;6(3):e03540.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Ross HE, Young LJ. Oxytocin and the neural mechanisms regulating social cognition and affiliative behavior. Front Neuroendocr. 2009;30(4):534–47.

    Article  CAS  Google Scholar 

  20. Gimpl G, Fahrenholz F. The oxytocin receptor system: structure, function, and regulation. Physiol Rev. 2001;81(2):629–83.

    Article  CAS  PubMed  Google Scholar 

  21. Frazer KA, Ballinger DG, Cox DR, Hinds DA, Stuve LL, Gibbs RA, et al. A second generation human haplotype map of over 3.1 million SNPs. Nature. 2007;449(7164):851–61.

    Article  CAS  PubMed  Google Scholar 

  22. Tansey KE, Brookes KJ, Hill MJ, Cochrane LE, Gill M, Skuse D, et al. Oxytocin receptor (OXTR) does not play a major role in the aetiology of autism: genetic and molecular studies. Neurosci Lett. 2010;474(3):163–7.

    Article  CAS  PubMed  Google Scholar 

  23. Wu S, Jia M, Ruan Y, Liu J, Guo Y, Shuang M, et al. Positive association of the oxytocin receptor gene (OXTR) with autism in the Chinese Han population. Biol Psychiatry. 2005;58(1):74–7.

    Article  CAS  PubMed  Google Scholar 

  24. Nyffeler J, Walitza S, Bobrowski E, Gundelfinger R, Grünblatt E. Association study in siblings and case-controls of serotonin-and oxytocin-related genes with high functioning autism. J Mol Psychiatry. 2014;2(1):1–9.

    Article  PubMed  PubMed Central  Google Scholar 

  25. Di Napoli A, Warrier V, Baron-Cohen S, Chakrabarti B. Genetic variation in the oxytocin receptor (OXTR) gene is associated with Asperger Syndrome. Mol Autism. 2014;5(1):1–7.

    Article  Google Scholar 

  26. Skuse DH, Lori A, Cubells JF, Lee I, Conneely KN, Puura K et al. Common polymorphism in the oxytocin receptor gene (OXTR) is associated with human social recognition skills. Proceedings of the National Academy of Sciences. 2014;111(5):1987-92.

  27. Yang S, Dong X, Guo X, Han Y, Song H, Gao L, et al. Serum oxytocin levels and an oxytocin receptor gene polymorphism (rs2254298) indicate social deficits in children and adolescents with autism spectrum disorders. Front NeuroSci. 2017;11:221.

    Article  PubMed  PubMed Central  Google Scholar 

  28. Reuter M, Montag C, Altmann S, Bendlow F, Elger C, Kirsch P, et al. Functional characterization of an oxytocin receptor gene variant (rs2268498) previously associated with social cognition by expression analysis in vitro and in human brain biopsy. Soc Neurosci. 2017;12(5):604–11.

    Article  PubMed  Google Scholar 

  29. Melchers M, Montag C, Felten A, Reuter M. The oxytocin receptor gene and social perception. Soc Neurosci. 2015;10(4):345–53.

    PubMed  Google Scholar 

  30. Melchers M, Montag C, Markett S, Reuter M. Relationship between oxytocin receptor genotype and recognition of facial emotion. Behav Neurosci. 2013;127(5):780–7.

    Article  CAS  PubMed  Google Scholar 

  31. Christ CC, Carlo G, Stoltenberg SF. Oxytocin receptor (OXTR) single nucleotide polymorphisms indirectly predict Prosocial Behavior through Perspective taking and empathic concern. J Pers. 2016;84(2):204–13.

    Article  PubMed  Google Scholar 

  32. Tops M, Van Ijzendoorn MH, Riem MM, Boksem MA, Bakermans-Kranenburg MJ. Oxytocin receptor gene associated with the efficiency of social auditory processing. Front Psychiatry. 2011;2:60.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Chander RJ, Mather KA, Cleary R, Grainger SA, Thalamuthu A, Numbers K, et al. The influence of rs53576 polymorphism in the oxytocin receptor (OXTR) gene on empathy in healthy adults by subtype and ethnicity: a systematic review and meta-analysis. Rev Neurosci. 2022;33(1):43–57.

    Article  CAS  PubMed  Google Scholar 

  34. Schneider-Hassloff H, Straube B, Jansen A, Nuscheler B, Wemken G, Witt SH, et al. Oxytocin receptor polymorphism and childhood social experiences shape adult personality, brain structure and neural correlates of mentalizing. NeuroImage. 2016;134:671–84.

    Article  CAS  PubMed  Google Scholar 

  35. Lucht MJ, Barnow S, Sonnenfeld C, Ulrich I, Grabe HJ, Schroeder W, et al. Associations between the oxytocin receptor gene (OXTR) and mind-reading in humans—An exploratory study. Nord J Psychiatry. 2013;67(1):15–21.

    Article  PubMed  Google Scholar 

  36. Opitz T, Schuwerk T, Paulus M, Kloo D, Osterhaus C, Lesch KP, et al. No links between genetic variation and developing theory of mind: a preregistered replication attempt of candidate gene studies. Dev Sci. 2021;24(5):e13100.

    Article  PubMed  Google Scholar 

  37. Šimleša S, Hacin K, Cepanec M, Ivšac-Pavliša J. Importance of language for children’s theory of mind: comparison of verbal and nonverbal theory of mind tasks. Psihologija. 2021;54(2):123–35.

    Article  Google Scholar 

  38. Happé FG. An advanced test of theory of mind: understanding of story characters’ thoughts and feelings by able autistic, mentally handicapped, and normal children and adults. J Autism Dev Disord. 1994;24(2):129–54.

    Article  PubMed  Google Scholar 

  39. Kobayashi C, Glover GH, Temple E. Children’s and adults’ neural bases of verbal and nonverbal ‘theory of mind’. Neuropsychologia. 2007;45(7):1522–32.

    Article  PubMed  PubMed Central  Google Scholar 

  40. Abell F, Happe F, Frith U. Do triangles play tricks? Attribution of mental states to animated shapes in normal and abnormal development. Cogn Dev. 2000;15(1):1–16.

    Article  Google Scholar 

  41. Shahrivar Z, Tehrani-Doost M, Khorrami Banaraki A, Mohammadzadeh A, Happe F. Normative data and psychometric properties of a farsi translation of the strange stories test. Autism Research: Official Journal of the International Society for Autism Research. 2017;10(12):1960–7.

    Article  PubMed  Google Scholar 

  42. Shahrivar Z, Tehrani-Doost M, Khorrami Banaraki A, Mohammadzadeh A. Normative Data and reliability of the moving shapes paradigm. Iran J Psychiatry. 2020;15(2):143–9.

    PubMed  PubMed Central  Google Scholar 

  43. Chlebowski C, Green JA, Barton ML, Fein D. Using the childhood autism rating scale to diagnose autism spectrum disorders. J Autism Dev Disord. 2010;40:787–99.

    Article  PubMed  PubMed Central  Google Scholar 

  44. Mayes SD, Calhoun SL, Murray MJ, Morrow JD, Yurich KK, Cothren S, et al. Use of the childhood autism rating scale (CARS) for children with high functioning autism or Asperger syndrome. Focus on Autism and Other Developmental Disabilities. 2012;27(1):31–8.

    Article  Google Scholar 

  45. Shahrivar Z, Tehrani-Doost M, Banaraki AK, Mohammadzadeh A. Normative Data and reliability of the moving shapes paradigm. Iran J Psychiatry. 2020;15(2):143.

    PubMed  PubMed Central  Google Scholar 

  46. Shahrivar Z, Tehrani-Doost M, Khorrami Banaraki A, Mohammadzadeh A, Happe F. Normative data and psychometric properties of a Farsi translation of the strange stories test. Autism Res. 2017;10(12):1960–7.

    Article  PubMed  Google Scholar 

  47. Lakatosova S, Dudova L, Pivovarciova A, Husarova V, Babinska K, Kubranska A, et al. Association with autism of two polymorphisms in gene encoding oxytocin receptors in Slovakia. Autism. 2013;3(121):104172.

    Google Scholar 

  48. Bašić J, Milošević V, Stanković M, Jevtović-Stoimenov T, Cvetković T, Despotović M, et al. The influence of rs53576 and rs2254298 oxytocin receptor gene polymorphisms on plasma oxytocin levels and measures of empathy. Archives of Biological Sciences. 2019;71(1):159–65.

    Article  Google Scholar 

  49. Lucht MJ, Barnow S, Sonnenfeld C, Rosenberger A, Grabe HJ, Schroeder W, et al. Associations between the oxytocin receptor gene (OXTR) and affect, loneliness and intelligence in normal subjects. Prog Neuropsychopharmacol Biol Psychiatry. 2009;33(5):860–6.

    Article  CAS  PubMed  Google Scholar 

  50. Ghamari R, Tahmaseb M, Alizadeh F, Mohammadzadeh A, Tavakolian N, Sarabi-Jamab A et al. Alterations in the transcript level of the Contactin Associated Protein 2 gene could conceivably influence verbal theory of mind and predict autism spectrum disorder incidence. 2023.

  51. Gemmer A, Mirkes K, Anneser L, Eilers T, Kibat C, Mathuru A, et al. Oxytocin receptors influence the development and maintenance of social behavior in zebrafish (Danio rerio). Sci Rep. 2022;12(1):1–13.

    Article  Google Scholar 

  52. King LB, Walum H, Inoue K, Eyrich NW, Young LJ. Variation in the oxytocin receptor gene predicts brain region–specific expression and social attachment. Biol Psychiatry. 2016;80(2):160–9.

    Article  CAS  PubMed  Google Scholar 

  53. Unternaehrer E, Meyer AH, Burkhardt SC, Dempster E, Staehli S, Theill N, et al. Childhood maternal care is associated with DNA methylation of the genes for brain-derived neurotrophic factor (BDNF) and oxytocin receptor (OXTR) in peripheral blood cells in adult men and women. Stress. 2015;18(4):451–61.

    Article  CAS  PubMed  Google Scholar 

  54. LoParo D, Waldman ID. The oxytocin receptor gene (OXTR) is associated with autism spectrum disorder: a meta-analysis. Mol Psychiatry. 2015;20(5):640–6.

    Article  CAS  PubMed  Google Scholar 

  55. Tops S, Habel U, Radke S. Genetic and epigenetic regulatory mechanisms of the oxytocin receptor gene (OXTR) and the (clinical) implications for social behavior. Horm Behav. 2019;108:84–93.

    Article  CAS  PubMed  Google Scholar 

  56. de Oliveira Pereira Ribeiro L, Vargas-Pinilla P, Kappel DB, Longo D, Ranzan J, Becker MM, et al. Evidence for Association between OXTR Gene and ASD Clinical Phenotypes. J Mol Neuroscience: MN. 2018;65(2):213–21.

    Article  Google Scholar 

  57. Kohlhoff J, Cibralic S, Hawes DJ, Eapen V. Oxytocin receptor gene (OXTR) polymorphisms and social, emotional and behavioral functioning in children and adolescents: a systematic narrative review. Neurosci Biobehav Rev. 2022;135:104573.

    Article  CAS  Google Scholar 

  58. Parker KJ, Garner JP, Libove RA, Hyde SA, Hornbeak KB, Carson DS, et al. Plasma oxytocin concentrations and OXTR polymorphisms predict social impairments in children with and without autism spectrum disorder. Proc Natl Acad Sci USA. 2014;111(33):12258–63.

    Article  CAS  PubMed Central  Google Scholar 

  59. Smarius L, Strieder TGA, Doreleijers TAH, Vrijkotte TGM, Zafarmand MH, de Rooij SR. Common oxytocin polymorphisms interact with maternal verbal aggression in early infancy impacting blood pressure at age 5–6: the ABCD study. PLoS ONE. 2019;14(6):e0216035.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  60. Sicorello M, Dieckmann L, Moser D, Lux V, Luhmann M, Schlotz W, et al. Oxytocin and the stress buffering effect of social company: a genetic study in daily life. Soc Cogn Affect Neurosci. 2020;15(3):293–301.

    Article  PubMed  PubMed Central  Google Scholar 

  61. Laursen HR, Siebner HR, Haren T, Madsen K, Grønlund R, Hulme O, et al. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy. Front Behav Neurosci. 2014;8:423.

    Article  PubMed  PubMed Central  Google Scholar 

  62. Meixner F, Montag C, Herbert C, Affective Language. Interpretation Bias and its Molecular Genetic variations: exploring the relationship between genetic variations of the OXTR Gene (rs53576 and rs2268498) and the emotional evaluation of words related to the self or the other. Front Psychol. 2019;10:68.

    Article  PubMed  PubMed Central  Google Scholar 

  63. Kim HW, Kang JI, An SK, Kim SJ. Oxytocin receptor gene variants are associated with emotion recognition and resilience, but not with false-belief reasoning performance in healthy young Korean volunteers. CNS Neurosci Ther. 2019;25(4):519–26.

    Article  PubMed  Google Scholar 

  64. Montag C, Sindermann C, Melchers M, Jung S, Luo R, Becker B, et al. A functional polymorphism of the OXTR gene is associated with autistic traits in caucasian and Asian populations. Am J Med Genet Part B Neuropsychiatric Genetics: Official Publication Int Soc Psychiatric Genet. 2017;174(8):808–16.

    Article  CAS  Google Scholar 

  65. Baribeau DA, Dupuis A, Paton TA, Scherer SW, Schachar RJ, Arnold PD, et al. Oxytocin receptor polymorphisms are differentially Associated with Social abilities across Neurodevelopmental disorders. Sci Rep. 2017;7(1):11618.

    Article  PubMed  PubMed Central  Google Scholar 

  66. Melchers M, Montag C, Markett S, Niazy N, Groß-Bölting J, Zimmermann J, et al. The OXTR gene, implicit learning and social processing: does empathy evolve from perceptual skills for details? Behav Brain Res. 2017;329:35–40.

    Article  CAS  PubMed  Google Scholar 

  67. Nishizato M, Fujisawa TX, Kosaka H, Tomoda A. Developmental changes in social attention and oxytocin levels in infants and children. Sci Rep. 2017;7(1):2540.

    Article  PubMed  PubMed Central  Google Scholar 

  68. Giralt-López M, Miret S, Soler J, Campanera S, Parellada M, Fañanás L, et al. The role of schizotypal traits and the OXTR gene in theory of mind in schizophrenia: a family-based study. Eur Psychiatry: J Association Eur Psychiatrists. 2020;63(1):e15.

    Article  Google Scholar 

  69. Gong P, Fan H, Liu J, Yang X, Zhang K, Zhou X. Revisiting the impact of OXTR rs53576 on empathy: a population-based study and a meta-analysis. Psychoneuroendocrinology. 2017;80:131–6.

    Article  CAS  PubMed  Google Scholar 

  70. McDonald NM, Baker JK, Messinger DS. Oxytocin and parent-child interaction in the development of empathy among children at risk for autism. Dev Psychol. 2016;52(5):735–45.

    Article  PubMed  PubMed Central  Google Scholar 

  71. Li J, Zhao Y, Li R, Broster LS, Zhou C, Yang S. Association of Oxytocin Receptor Gene (OXTR) rs53576 polymorphism with sociality: a Meta-analysis. PLoS ONE. 2015;10(6):e0131820.

    Article  PubMed  PubMed Central  Google Scholar 

  72. Oksman E, Rosenström T, Hintsanen M, Pulkki-Råback L, Viikari J, Lehtimäki T, et al. A longitudinal Multilevel Study of the Social Genotype and diversity of the phenotype. Front Psychol. 2018;9:2034.

    Article  PubMed  PubMed Central  Google Scholar 

  73. Burkhouse KL, Woody ML, Owens M, McGeary JE, Knopik VS, Gibb BE. Sensitivity in detecting facial displays of emotion: impact of maternal depression and oxytocin receptor genotype. Cognition & Emotion. 2016;30(2):275–87.

    Article  Google Scholar 

  74. Slane MM, Lusk LG, Boomer KB, Hare AE, King MK, Evans DW. Social cognition, face processing, and oxytocin receptor single nucleotide polymorphisms in typically developing children. Dev Cogn Neurosci. 2014;9:160–71.

    Article  PubMed  PubMed Central  Google Scholar 

  75. Jacob S, Brune CW, Carter CS, Leventhal BL, Lord C, Cook EH. Jr. Association of the oxytocin receptor gene (OXTR) in caucasian children and adolescents with autism. Neurosci Lett. 2007;417(1):6–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  76. Nyffeler J, Walitza S, Bobrowski E, Gundelfinger R, Grünblatt E. Association study in siblings and case-controls of serotonin- and oxytocin-related genes with high functioning autism. J Mol Psychiatry. 2014;2(1):1.

    Article  PubMed  PubMed Central  Google Scholar 

  77. Rijlaarsdam J, van Verhulst IMH, Jaddoe FC, Felix VW, Tiemeier JF. Prenatal stress exposure, oxytocin receptor gene (OXTR) methylation, and child autistic traits: the moderating role of OXTR rs53576 genotype. Autism Research: Official Journal of the International Society for Autism Research. 2017;10(3):430–8.

    Article  PubMed  Google Scholar 

  78. Nakata Y, Kanahara N, Kimura A, Niitsu T, Komatsu H, Oda Y, et al. Oxytocin system dysfunction in patients with treatment-resistant schizophrenia: alterations of blood oxytocin levels and effect of a genetic variant of OXTR. J Psychiatr Res. 2021;138:219–27.

    Article  PubMed  Google Scholar 

  79. Ríos U, Morán J, Hermosilla J, González R, Muñoz P, Arancibia M, et al. The interaction of the oxytocin receptor gene and Child Abuse subtypes on social cognition in euthymic patients with bipolar disorder type I. Front Psychiatry. 2023;14:1151397.

    Article  PubMed  PubMed Central  Google Scholar 

  80. Park J, Willmott M, Vetuz G, Toye C, Kirley A, Hawi Z, et al. Evidence that genetic variation in the oxytocin receptor (OXTR) gene influences social cognition in ADHD. Prog Neuro-psychopharmacol Biol Psychiatry. 2010;34(4):697–702.

    Article  CAS  Google Scholar 

  81. Choi D, Minote N, Watanuki S. Associations between the oxytocin receptor gene (OXTR) rs53576 polymorphism and emotional processing of social and nonsocial cues: an event-related potential (ERP) study. J Physiol Anthropol. 2017;36(1):12.

    Article  PubMed  PubMed Central  Google Scholar 

  82. Luo S, Li B, Ma Y, Zhang W, Rao Y, Han S. Oxytocin receptor gene and racial ingroup bias in empathy-related brain activity. NeuroImage. 2015;110:22–31.

    Article  CAS  PubMed  Google Scholar 

  83. Meyer M, Jurek B, Alfonso-Prieto M, Ribeiro R, Milenkovic VM, Winter J, et al. Structure-function relationships of the disease-linked A218T oxytocin receptor variant. Mol Psychiatry. 2022;27(2):907–17.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  84. Haas BW, Anderson IW, Smith JM. Navigating the complex path between the oxytocin receptor gene (OXTR) and cooperation: an endophenotype approach. Front Hum Neurosci. 2013;7:801.

    Article  PubMed  PubMed Central  Google Scholar 

  85. Uzefovsky F, Bethlehem RAI, Shamay-Tsoory S, Ruigrok A, Holt R, Spencer M, et al. The oxytocin receptor gene predicts brain activity during an emotion recognition task in autism. Mol Autism. 2019;10:12.

    Article  PubMed  PubMed Central  Google Scholar 

  86. Wang J, Zhang Y, Zhu D, Yang Z, Liu F, Qin W, et al. A common variant in OXTR rs53576 impacts topological patterns of brain functional networks. Eur Child Adolesc Psychiatry. 2020;29(7):993–1002.

    Article  PubMed  Google Scholar 

  87. Zimmermann J, Deris N, Montag C, Reuter M, Felten A, Becker B, et al. A common polymorphism on the oxytocin receptor gene (rs2268498) and resting-state functional connectivity of amygdala subregions - a genetic imaging study. NeuroImage. 2018;179:1–10.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We want to extend my gratitude to all individuals and their parents who participated in this study.

Funding

The study was funded by no special organization or institute.

Author information

Authors and Affiliations

  1. Department of Cellular and Molecular Biology, Faculty of Biological Sciences, Kharazmi University, Tehran, Iran

    Rana Ghamari & Mohammad Tahmaseb

  2. Research Center for Cognitive and Behavioral Sciences, Roozbeh Psychiatry Hospital, Tehran University of Medical Sciences, Tehran, Iran

    Azar Mohammadzadeh & Mehdi Tehrani-Doost

  3. Department of Genomic Psychiatry and Behavioral Genomics (DGPBG), School of Medicine, Roozbeh Hospital, Tehran University of Medical Sciences (TUMS), Tehran, Iran

    Fatemeh Alizadeh

  4. School of Cognitive Sciences, Institute for Research in Fundamental Sciences (IPM), Tehran, Iran

    Atiye Sarabi-Jamab

  5. Department of Cellular and Molecular Science, Roshd Azma Company, Alborz, Iran

    Seyed-Alireza Etesami

  6. Department of Psychiatry, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

    Mehdi Tehrani-Doost

Authors
  1. Rana Ghamari
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Mohammad Tahmaseb
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Atiye Sarabi-Jamab
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Seyed-Alireza Etesami
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Azar Mohammadzadeh
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Fatemeh Alizadeh
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Mehdi Tehrani-Doost
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Rana Ghamari: conception and design, acquisition of data, analysis and interpretation of data and writing the draft. Mohammad Tahmaseb: data collecting. Atiye Sarabi-Jamab: data collecting, analysis of data, and revising final draft. Seyed-Alireza Etesami: data collecting. Azar Mohammadzadeh: data collecting. Fatemeh Alizadeh: data collecting, Mehdi Tehrani-Doost: conception and design, acquisition of data, analysis and interpretation of data and revision of the draft.

Corresponding authors

Correspondence to Fatemeh Alizadeh or Mehdi Tehrani-Doost.

Ethics declarations

Ethics approval and consent to participate

The informed consent was obtained from all participants’ parents and steps of this study ethically were approved by the Tehran University of Medical Sciences Research Ethics Committee (IR.KHU.REC.1399.021) based on Helsinki declaration.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1: Table 1.

Demographic results of participants. Table 2. Genotype distribution and HWE results of rs2268498 and rs53576

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Ghamari, R., Tahmaseb, M., Sarabi-Jamab, A. et al. Association of verbal and non-verbal theory of mind abilities with non-coding variants of OXTR in youth with autism spectrum disorder and typically developing individuals: a case-control study. BMC Psychiatry 24, 30 (2024). https://doi.org/10.1186/s12888-023-05461-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12888-023-05461-w

Keywords

BMC Psychiatry

ISSN: 1471-244X

Contact us